Dictionary > Frameshift mutation

Frameshift mutation


Reviewed by: Mary Anne Clark, PhD


Definition
noun, plural: frameshift mutations
(genetics) A type of gene mutationin which the addition or deletion of one or more nucleotide(s) causes a shift in the reading frame of the codons in the mRNA, which may lead to the alteration in the amino acid sequence at protein translation.

The reading frame of any mRNA is the coding sequence for a given polypeptide and is read continuously from the start codon AUG to one of the three stop codons. In translation, the ribosome moves down the mRNA 3 bases at a time and reads whatever codons follow the start codon. Adding or subtracting one or two bases (or any other number that is not a multiple of 3) can disrupt the normal reading frame and lead to the production of a completely nonfunctional protein. Frame shifts may also accidentally introduce an early stop codon.

Example:
Original coding sequence: atggtgcatctgactcctgaggagaagtct
Amino acid translation: M V H L T P E E K S

Frameshift (remove underlined at): atggtgcctgactccTGAggagaagtct
Amino acid translation: M V P D S * G E V X (* = termination at the TGA stop codon generated)

Supplement
Frameshift mutations may be beneficial, deleterious, or lethal. For example, induction of frameshift mutation has been used to make certain bacteria capable of producing nylonase, an enzyme that can degrade nylon.

Some cases of albinism have been attributed to early termination of any of the enzymes necessary for the production of melanin. Tay Sachs disease is caused by various mutations, including frameshift mutations, in the HEXA gene, a gene on chromosome 15 that codes for the alpha-subunit of the lysosomal enzyme beta-N-acetylhexosaminidase A.

Variant(s):

  • frame shift mutation

Compare:

See also:


You will also like...